Adam22^em3Mafu
Endonuclease-mediated Allele Detail

Summary

• Symbol: Adam22^em3Mafu
• Name: a disintegrin and metallopeptidase domain 22; endonuclease-mediated mutation 3, Masaki Fukata
• MGI ID: MGI:7466594
• Synonyms: Adam22^S832A, Adam22^SA
• Gene: Adam22 Location: Chr5:8122352-8418160 bp, - strand Genetic Position: Chr5, 3.39 cM
• Alliance: Adam22^em3Mafu page

Mutation origin

• Strain of Origin: (C57BL/6 X DBA/2)F1 x C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Single point mutation
• Mutation details: Serine codon 832 (TCC) in exon 28 was changed to alanine (GCC) (p.S832A) using an sgRNA (targeting CCTTGCCAGGAGTTACTGCG) and ssODN template with CRISPR/Cas9 technology. This mutation prevents phosphorylation of the residue. (J:328338)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Adam22 Mutation: 71 strains or lines available

References

• Original: J:328338 Yokoi N, et al., 14-3-3 proteins stabilize LGI1-ADAM22 levels to regulate seizure thresholds in mice. Cell Rep. 2021 Dec 14;37(11):110107
• All: 1 reference(s)