About   Help   FAQ
Defa30em1Irc
Endonuclease-mediated Allele Detail
Summary
Symbol: Defa30em1Irc
Name: defensin, alpha, 30; endonuclease-mediated mutation 1, Inflammation Research Center
MGI ID: MGI:7464723
Gene: Defa30  Location: Chr8:21624658-21625614 bp, + strand  Genetic Position: Chr8, 10.35 cM
Alliance: Defa30em1Irc page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Epitope tag)
Mutation:    Insertion
 
Mutation detailsThis allele was generated by the Transgenic Core Facility (TCF) of the Inflammation Research Center (IRC) of VIB-Ugent by electroporating Cas9 RNP complex with guide RNA sequence 5' CATGGTCATCTTGTTCTCTG 3' and single stranded DNA oligo with sequence 5' AGAAGTGGTCATCAGGCACCAGCGTCAGTGGCCTCAGTACTCATGGTCATCTTGTTCTCTcTGGTCTCCATGTTCAgtggtgatggtgatgatgtccggagccGCGACAGCAGAGCATGTACATTAAATGACCCTTACTGCAGGTCCCATTCATGCGTTCTCT 3' in C57BL/6J zygotes which resulted in the addition of a C-terminal GSG-linker and His-tag to the coding sequence of the gene (ENSMUSG00000074444). The GSG-linker + His-tag was inserted directly before the stop codon of the gene at position (chr8:21625516). All base annotations are according to C57BL/6J genome assembly GRCm39. (J:361591)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Defa30 Mutation:  13 strains or lines available
References
Original:  J:361591 Hochepied T, DDS Inflammation Research Center. MGI Direct Data Submission. 2025;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory