Best3em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Best3em1(IMPC)J |
Name: |
bestrophin 3; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:7464720 |
Gene: |
Best3 Location: Chr10:116822219-116860945 bp, + strand Genetic Position: Chr10, 65.0 cM
|
Alliance: |
Best3em1(IMPC)J page
|
IMPC: |
Best3 gene page |
|
Strain of Origin: |
Not Applicable
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTTGGGTGCATAACACCCGG and AATACTTCCAAGGAGCCTGA, which resulted in a 469 bp deletion beginning at Chromosome 10 position 117,002,370 bp and ending after 117,002,838 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000101368 (exon 5) and 314 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 161 and early truncation 54 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
1 reference(s) |
|