Map10^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Map10^em1(IMPC)J
• Name: microtubule-associated protein 10; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7463972
• Gene: Map10 Location: Chr8:126396557-126400098 bp, + strand Genetic Position: Chr8, 73.65 cM, cytoband E2
• Alliance: Map10^em1(IMPC)J page
• IMPC: Map10 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCAATGGCGACCACGGCGGC and GCAGATGTCTTTGCACTGTC, which resulted in a 2611 bp deletion beginning at Chromosome 8 position 125,669,882 bp and ending after 125,672,492 bp (GRCm38/mm10). This mutation deletes 2611 bp of ENSMUSE00000346397 (exon 1) and is predicted to cause a change of amino acid sequence after residue 5 and early truncation 5 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Map10 Mutation: 29 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)