Atosbem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Atosbem1(IMPC)J |
Name: |
atos homolog B; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:7463966 |
Gene: |
Atosb Location: Chr4:43032414-43046220 bp, - strand Genetic Position: Chr4, 22.99 cM
|
Alliance: |
Atosbem1(IMPC)J page
|
IMPC: |
Atosb gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATCCCAGCCTAAGATCTCAT and GCAGAGCTTGTCCCAAAGCG, which resulted in a 4988 bp deletion beginning at Chromosome 4 position 43,032,325 bp and ending after 43,037,312 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000362071, ENSMUSE00000342963, ENSMUSE00000390285, ENSMUSE00001303795, ENSMUSE00001252670, ENSMUSE00001212016, ENSMUSE00001285070, ENSMUSE00001213061 (exons 2-9) and 2031 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to result in a null allele.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
1 reference(s) |
|