Armc10^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Armc10^em1(IMPC)J
• Name: armadillo repeat containing 10; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7461753
• Gene: Armc10 Location: Chr5:21851004-21867697 bp, + strand Genetic Position: Chr5, 9.97 cM, cytoband A3
• Alliance: Armc10^em1(IMPC)J page
• IMPC: Armc10 gene page

Mutation origin

• Strain of Origin: Not Applicable
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTAGCGCCTCCCCTCCCAC and GGATAGCTAAGAGTTCAGAA, which resulted in a 482 bp deletion beginning at Chromosome 5 position 21,648,332 bp and ending after 21,648,813 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000602887 (exon 2) and 333 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 44 and early truncation 4 amino acids later. There is a 7 bp (CCCCCCC) insertion at the deletion site. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Armc10 Mutation: 21 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)