Cfap100^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cfap100^em1(IMPC)J
• Name: cilia and flagella associated protein 100; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7450836
• Gene: Cfap100 Location: Chr6:90380461-90405779 bp, - strand Genetic Position: Chr6, 40.16 cM
• Alliance: Cfap100^em1(IMPC)J page
• IMPC: Cfap100 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGCTGGCAGGAACACAGGGG and CTAAAATCAAGATCCAGCAG, which resulted in a 349 bp deletion beginning at Chromosome 6 position 90,412,077 bp and ending after 90,412,425 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001260855 and ENSMUSE00000452276 (exons 10 and 11) and 180 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 308 and early truncation 28 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cfap100 Mutation: 31 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)