Ttc12^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ttc12^em1(IMPC)J
• Name: tetratricopeptide repeat domain 12; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7450833
• Gene: Ttc12 Location: Chr9:49348263-49397525 bp, - strand Genetic Position: Chr9, 26.83 cM
• Alliance: Ttc12^em1(IMPC)J page
• IMPC: Ttc12 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCAAGGGTAGACAGTATCGT and GCTGGGCCAAACTAGAAAAC, which resulted in a 321 bp deletion beginning at Chromosome 9 position 49,470,103 bp and ending after 49,470,423 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001296287 (exon 6) and 199 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 106 and early truncation 15 amino acids later. There is a 5 bp insertion (TCACT) at the deletion site. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ttc12 Mutation: 28 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)