Nfil3^em1.1Kmm
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nfil3^em1.1Kmm
• Name: nuclear factor, interleukin 3, regulated; endonuclease-mediated mutation 1.1, Kenneth M Murphy
• MGI ID: MGI:7448469
• Synonyms: Nfil3^GFP
• Gene: Nfil3 Location: Chr13:53121245-53135109 bp, - strand Genetic Position: Chr13, 27.68 cM
• Alliance: Nfil3^em1.1Kmm page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Reporter)
• Mutation: Insertion
• Mutation details: Using an sgRNA (targeting GAAGATTTGCTCCTGAACGA) with CRISPR/Cas9 technology, the GFP fluorescent reporter gene was inserted upstream of the Nfil3 start site with a linker sequence (coding for GGSG) in-between, and a loxP site flanked neomycin resistance gene cassette was inserted 411 bp upstream of the Nfil3 coding sequence. The neo cassette was removed through subsequent Cre-mediated recombination. This allele expresses a chimeric GFP-Nfil3 peptide. (J:334296)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Nfil3 Mutation: 33 strains or lines available

References

• Original: J:334296 Liu TT, et al., Ablation of cDC2 development by triple mutations within the Zeb2 enhancer. Nature. 2022 Jul;607(7917):142-148
• All: 1 reference(s)