Rr400^em2Pqt
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr400^em2Pqt
• Name: regulatory region 400; endonuclease-mediated mutation 2, Paul Q Thomas
• MGI ID: MGI:7447462
• Synonyms: -208
• Gene: Rr400 Location: Chr3:87881638-87881892 bp Genetic Position: Chr3, Syntenic
• Alliance: Rr400^em2Pqt page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intragenic deletion
• Mutation details: The Nestin enhancer in intron 2 was targeted with two sgRNAs (targeting TTTGCGGTCTGAAAAGGATT and AGAATCGGCCTCCCTCTCCG) using CRISPR/Cas9 technology, resulting in a 208 bp deletion (chr3:87881630-87881837 (GRCm39)). (J:314040)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr400 Mutation: 0 strains or lines available

References

• Original: J:314040 Thomson E, et al., The Nestin neural enhancer is essential for normal levels of endogenous Nestin in neuroprogenitors but is not required for embryo development. PLoS One. 2021;16(11):e0258538
• All: 1 reference(s)