Sema4f^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Sema4f^em1(IMPC)J
• Name: sema domain, immunoglobulin domain (Ig), TM domain, and short cytoplasmic domain; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7447135
• Gene: Sema4f Location: Chr6:82888865-82916724 bp, - strand Genetic Position: Chr6, 35.94 cM
• Alliance: Sema4f^em1(IMPC)J page
• IMPC: Sema4f gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTGGTAGTCACAGTCACGCG and TTCTAGGGATGCTTTCATGG, which resulted in a 554 bp deletion beginning at Chromosome 6 position 82,907,725 bp and ending after 82,908,278 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000194640 (exon 5) and 460 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 158 and early truncation 8 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Sema4f Mutation: 44 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)