Bpifb6em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Bpifb6em1(IMPC)J |
Name: |
BPI fold containing family B, member 6; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:7447043 |
Gene: |
Bpifb6 Location: Chr2:153742308-153754715 bp, + strand Genetic Position: Chr2, 75.99 cM
|
Alliance: |
Bpifb6em1(IMPC)J page
|
IMPC: |
Bpifb6 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATGTACAATGAGAACTGAG and CACAGCGTGCAAAATTACCA, which resulted in a 1177 bp deletion beginning at Chromosome 2 position 153,903,913 bp and ending after 153,905,089 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000555395, ENSMUSE00000555393, and ENSMUSE00000555390 (exons 5, 6, and 7) and 867 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 66 and early truncation 12 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
1 reference(s) |
|