About   Help   FAQ
Ranbp3lem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ranbp3lem1(IMPC)J
Name: RAN binding protein 3-like; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7447006
Gene: Ranbp3l  Location: Chr15:8997433-9067417 bp, + strand  Genetic Position: Chr15, 3.82 cM
Alliance: Ranbp3lem1(IMPC)J page
IMPC: Ranbp3l gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTAGGCAAAAAGTGAGCAG and CCAGCTGTCCAACATCAGAG, which resulted in a 561 bp deletion beginning at Chromosome 15 position 9,007,125 bp and ending after 9,007,685 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001434081 (exon 7) and 418 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 138 and early truncation 2 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ranbp3l Mutation:  37 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory