Atoh1^em2Zyliu
Endonuclease-mediated Allele Detail

Summary

• Symbol: Atoh1^em2Zyliu
• Name: atonal bHLH transcription factor 1; endonuclease-mediated mutation 2, Zhiyong Liu
• MGI ID: MGI:7446983
• Synonyms: Atoh1-3*V5-P2A-Tdtomato, Atoh1^em1Zyliu, Atoh1-Tdtomato KI
• Gene: Atoh1 Location: Chr6:64706109-64708229 bp, + strand Genetic Position: Chr6, 30.03 cM
• Alliance: Atoh1^em2Zyliu page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Epitope tag, Reporter)
• Mutation: Insertion
• Mutation details: The gene was targeted with an sgRNA (targeting CGCGCGCTAGGAAGGGCATT) and a double strand DNA template using CRISPR/Cas9 technology to insert the following immediately upstream of the stop codon in the single-exon gene: three copies of sequence coding for a V5 epitope tag, sequence coding for the P2A self-cleaving peptide and the tdTomato fluorescent reporter gene. This allele will express both the endogenous gene, with C-terminal V5 tags, and the reporter gene. (J:333396)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Atoh1 Mutation: 36 strains or lines available

References

• Original: J:333396 Luo Z, et al., Three distinct Atoh1 enhancers cooperate for sound receptor hair cell development. Proc Natl Acad Sci U S A. 2022 Aug 9;119(32):e2119850119
• All: 1 reference(s)