About   Help   FAQ
Atoh1em2Zyliu
Endonuclease-mediated Allele Detail
Summary
Symbol: Atoh1em2Zyliu
Name: atonal bHLH transcription factor 1; endonuclease-mediated mutation 2, Zhiyong Liu
MGI ID: MGI:7446983
Synonyms: Atoh1-3*V5-P2A-Tdtomato, Atoh1em1Zyliu, Atoh1-Tdtomato KI
Gene: Atoh1  Location: Chr6:64706109-64708229 bp, + strand  Genetic Position: Chr6, 30.03 cM
Alliance: Atoh1em2Zyliu page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Epitope tag, Reporter)
Mutation:    Insertion
 
Mutation detailsThe gene was targeted with an sgRNA (targeting CGCGCGCTAGGAAGGGCATT) and a double strand DNA template using CRISPR/Cas9 technology to insert the following immediately upstream of the stop codon in the single-exon gene: three copies of sequence coding for a V5 epitope tag, sequence coding for the P2A self-cleaving peptide and the tdTomato fluorescent reporter gene. This allele will express both the endogenous gene, with C-terminal V5 tags, and the reporter gene. (J:333396)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Atoh1 Mutation:  36 strains or lines available
References
Original:  J:333396 Luo Z, et al., Three distinct Atoh1 enhancers cooperate for sound receptor hair cell development. Proc Natl Acad Sci U S A. 2022 Aug 9;119(32):e2119850119
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory