Del(6Tas2r143-Tas2r126)7Osb
Endonuclease-mediated Allele Detail

Summary

• Symbol: Del(6Tas2r143-Tas2r126)7Osb
• Name: deletion, Chr 6, Research Institute for Microbial Diseases, Osaka University 7
• MGI ID: MGI:7446748
• Synonyms: Tas2r126/135/143^-
• Gene: Del(6Tas2r143-Tas2r126)7Osb Location: unknown Genetic Position: Chr6, Syntenic

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intergenic deletion
• Del(6Tas2r143-Tas2r126)7Osb involves 3 genes/genome features (Tas2r143, Tas2r135, Tas2r126) View all
• Mutation details: CRISPR-targeting using sgRNAs AGTGTTTTTGATCCAATAG and TGGAAGTGAGCTCATCTACG deleted the region between Tas2r143 and Tas2r126, which includes Tas2r143, Tas2r135, and Tas2r126. PCR of genomic DNA, RT-qPCR of bone marrow-derived neutrophils, and direct gene sequencing confirmed the deletion of all three genes. (J:334098)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Del(6Tas2r143-Tas2r126)7Osb Mutation: 0 strains or lines available

References

• Original: J:334098 Kobayashi D, et al., Tas2R signaling enhances mouse neutrophil migration via a ROCK-dependent pathway. Front Immunol. 2022;13:973880
• All: 1 reference(s)