About   Help   FAQ
Del(6Tas2r143-Tas2r126)7Osb
Endonuclease-mediated Allele Detail
Summary
Symbol: Del(6Tas2r143-Tas2r126)7Osb
Name: deletion, Chr 6, Research Institute for Microbial Diseases, Osaka University 7
MGI ID: MGI:7446748
Synonyms: Tas2r126/135/143-
Gene: Del(6Tas2r143-Tas2r126)7Osb  Location: unknown  Genetic Position: Chr6, Syntenic
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intergenic deletion
  Del(6Tas2r143-Tas2r126)7Osb involves 3 genes/genome features (Tas2r143, Tas2r135, Tas2r126) View all
 
Mutation detailsCRISPR-targeting using sgRNAs AGTGTTTTTGATCCAATAG and TGGAAGTGAGCTCATCTACG deleted the region between Tas2r143 and Tas2r126, which includes Tas2r143, Tas2r135, and Tas2r126. PCR of genomic DNA, RT-qPCR of bone marrow-derived neutrophils, and direct gene sequencing confirmed the deletion of all three genes. (J:334098)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Del(6Tas2r143-Tas2r126)7Osb Mutation:  0 strains or lines available
References
Original:  J:334098 Kobayashi D, et al., Tas2R signaling enhances mouse neutrophil migration via a ROCK-dependent pathway. Front Immunol. 2022;13:973880
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory