Rr392^em1Dhr
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr392^em1Dhr
• Name: regulatory region 392; endonuclease-mediated mutation 1, David H Raulet
• MGI ID: MGI:7442982
• Synonyms: Klra7^Hss5delta
• Gene: Rr392 Location: unknown Genetic Position: Chr6, Syntenic
• Alliance: Rr392^em1Dhr page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: The Klra7 enhancer was targeted with sgRNAs (targeting AGAACAGTCATTTCTTTAAA and AGAGGGATTACTCTGGGGAA) using CRISPR/Cas9 technology, resulting in a deletion (chr6:130212726-130213151 (GRCm39)). (J:333878)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr392 Mutation: 0 strains or lines available

References

• Original: J:333878 Kissiov DU, et al., Binary outcomes of enhancer activity underlie stable random monoallelic expression. Elife. 2022 May 26;11:e74204
• All: 1 reference(s)