Rr150102^em1Jdai
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr150102^em1Jdai
• Name: regulatory region 150102; endonuclease-mediated mutation 1, Jianwu Dai
• MGI ID: MGI:7440073
• Synonyms: E2 KO
• Gene: Rr150102 Location: Chr6:64750002-64750800 bp Genetic Position: Chr6, Syntenic
• Alliance: Rr150102^em1Jdai page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: Atoh1 enhancer E2 was targeted with sgRNAs (targeting GAAGTTTCACTGGACACTGGAGG and AATGACAGAGGTCTTGACAGAGG) using CRISPR/Cas9 technology, resulting in a deletion-insertion with an 890 bp deletion (chr6:64750197-64751086 (GRCm39)), including the enhancer, and a 1 bp insertion (C). (J:332270)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr150102 Mutation: 0 strains or lines available

References

• Original: J:332270 Shu M, et al., Single-cell chromatin accessibility identifies enhancer networks driving gene expression during spinal cord development in mouse. Dev Cell. 2022 Dec 19;57(24):2761-2775.e6
• All: 1 reference(s)