About   Help   FAQ
Rr150101em1Jdai
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr150101em1Jdai
Name: regulatory region 150101; endonuclease-mediated mutation 1, Jianwu Dai
MGI ID: MGI:7440070
Synonyms: E1 KO
Gene: Rr150101  Location: Chr6:64740801-64741205 bp  Genetic Position: Chr6, Syntenic
Alliance: Rr150101em1Jdai page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsAtoh1 enhancer E1 was targeted with sgRNAs (targeting GATTTAGACTCTACACTTGATGG and AGAGATATATTGGAAGGTATAGG) using CRISPR/Cas9 technology, resulting in a 1387 bp deletion (chr6:64740810-64742196 (GRCm39)) including the enhancer. (J:332270)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr150101 Mutation:  0 strains or lines available
References
Original:  J:332270 Shu M, et al., Single-cell chromatin accessibility identifies enhancer networks driving gene expression during spinal cord development in mouse. Dev Cell. 2022 Dec 19;57(24):2761-2775.e6
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory