Rr385^em1Srir
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr385^em1Srir
• Name: regulatory region 385; endonuclease-mediated mutation 1, Sridhar Rao
• MGI ID: MGI:7439545
• Synonyms: +60-enhancer-deleted
• Gene: Rr385 Location: Chr6:122740988-122743850 bp Genetic Position: Chr6, Syntenic
• Alliance: Rr385^em1Srir page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: The Nanog putative super-enhancer was targeted with sgRNAs (targeting ACCGTGGCTGCCGTATTATA and CTCGTTTGTAGCAAACAGCC) using CRISPR/Cas9, resulting in an ~10.5 kb deletion including the enhancer. (J:333571)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr385 Mutation: 0 strains or lines available

References

• Original: J:333571 Blinka S, et al., Super-Enhancers at the Nanog Locus Differentially Regulate Neighboring Pluripotency-Associated Genes. Cell Rep. 2016 Sep 27;17(1):19-28
• All: 1 reference(s)