Cdhr5^em1Mtys
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cdhr5^em1Mtys
• Name: cadherin-related family member 5; endonuclease-mediated mutation 1, Matthew J Tyska
• MGI ID: MGI:7439362
• Synonyms: Cdhr5-mCherry
• Gene: Cdhr5 Location: Chr7:140848996-140856699 bp, - strand Genetic Position: Chr7, 86.58 cM
• Alliance: Cdhr5^em1Mtys page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Reporter)
• Mutation: Insertion
• Mutation details: A Cdhr5 C-terminal fusion with mCherry. The crRNA GAAGACTCTCCGCTTTGGCG was used to insert a linker SGGGSGGGS followed by mCherry coding sequence at GRCm39, Chr7:140849065. (J:354663)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Cdhr5 Mutation: 28 strains or lines available

References

• Original: J:354663 Silverman JB, et al., Organization of a cytoskeletal superstructure in the apical domain of intestinal tuft cells. J Cell Biol. 2024;223(12):e202404070
• All: 1 reference(s)