About   Help   FAQ
Ncor1em4Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Ncor1em4Tcp
Name: nuclear receptor co-repressor 1; endonuclease-mediated mutation 4, The Centre for Phenogenomics
MGI ID: MGI:7439340
Gene: Ncor1  Location: Chr11:62207132-62348200 bp, - strand  Genetic Position: Chr11, 38.08 cM, cytoband B2
Alliance: Ncor1em4Tcp page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Single point mutation
 
Mutation details: 

This allele was generated at The Centre for Phenogenomics by injecting Cpf1 ribonucleoprotein complexes with a guide RNA with the spacer sequence ACTATAAAAGACGGCATAAT and a single-strand oligonucleotide. Subsequent NHEJ-mediated repair introduced an indel comprised of a 10-bp deletion from Chr11: 62269381 to 62269372 (GRCm39). The repair template was not integrated. This mutation is predicted to cause a frameshift with the amino acid changes after residue p.R671 and early truncation 125 amino acids later in ENSMUST00000018645.13. (J:200814)

Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Ncor1 Mutation:  396 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/08/2026
MGI 6.24
The Jackson Laboratory