Ncor1^em4Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ncor1^em4Tcp
• Name: nuclear receptor co-repressor 1; endonuclease-mediated mutation 4, The Centre for Phenogenomics
• MGI ID: MGI:7439340
• Gene: Ncor1 Location: Chr11:62207132-62348200 bp, - strand Genetic Position: Chr11, 38.08 cM, cytoband B2
• Alliance: Ncor1^em4Tcp page

Mutation origin

• Strain of Origin: C57BL/6NCrl

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Single point mutation
• Mutation details:

  This allele was generated at The Centre for Phenogenomics by injecting Cpf1 ribonucleoprotein complexes with a guide RNA with the spacer sequence ACTATAAAAGACGGCATAAT and a single-strand oligonucleotide. Subsequent NHEJ-mediated repair introduced an indel comprised of a 10-bp deletion from Chr11: 62269381 to 62269372 (GRCm39). The repair template was not integrated. This mutation is predicted to cause a frameshift with the amino acid changes after residue p.R671 and early truncation 125 amino acids later in ENSMUST00000018645.13. (J:200814)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ncor1 Mutation: 396 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 1 reference(s)