Ncor1^em3Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ncor1^em3Tcp
• Name: nuclear receptor co-repressor 1; endonuclease-mediated mutation 3, The Centre for Phenogenomics
• MGI ID: MGI:7439339
• Gene: Ncor1 Location: Chr11:62207132-62348200 bp, - strand Genetic Position: Chr11, 38.08 cM, cytoband B2
• Alliance: Ncor1^em3Tcp page

Mutation origin

• Strain of Origin: C57BL/6NCrl

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Single point mutation
• Mutation details:

  This allele was generated at The Centre for Phenogenomics by injecting Cpf1 ribonucleoprotein complexes with a guide RNA with the spacer sequence ACTATAAAAGACGGCATAATC and a single-strand oligonucleotide. Homology-directed repair generated an allele with the change c.A2043T predicted to result in p.Q681H in ENSMUST00000018645.12. (J:200814)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ncor1 Mutation: 396 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 1 reference(s)