Ubxn11em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Ubxn11em1(IMPC)J |
Name: |
UBX domain protein 11; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:7437469 |
Gene: |
Ubxn11 Location: Chr4:133829811-133854095 bp, + strand Genetic Position: Chr4, 66.5 cM, cytoband D3
|
Alliance: |
Ubxn11em1(IMPC)J page
|
IMPC: |
Ubxn11 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutations: |
|
Insertion, Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCACATGCGGTGCTTACAGC and GGGTTCTATTCAGCCCCACA, which resulted in a 1340 bp deletion beginning at Chromosome 4 position 134,112,348 bp and ending after 134,113,687 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001252036, ENSMUSE00001260575, and ENSMUSE00001254134 (exons 5, 6, and 7) and 1113 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 66 and early truncation 26 amino acids later. There is a single bp (A) insertion at the deletion site.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
1 reference(s) |
|