Ect2l^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ect2l^em1(IMPC)J
• Name: epithelial cell transforming sequence 2 oncogene-like; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7432300
• Gene: Ect2l Location: Chr10:18004651-18086638 bp, - strand Genetic Position: Chr10, 7.47 cM
• Alliance: Ect2l^em1(IMPC)J page
• IMPC: Ect2l gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTACCAGGAAAAGGCTTAAA and GCTGGGTAAGTGTCTCAAGG, which resulted in a 499 bp deletion beginning at Chromosome 10 position 18,173,871 bp and ending after 18,174,369 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000615953 (exon 4) and 246 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 126 and early truncation 10amino acids later. There is a 4 bp insertion at the deletion site (TGAA). (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ect2l Mutation: 53 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)