Lmna^em1Yuzha
Endonuclease-mediated Allele Detail

Summary

• Symbol: Lmna^em1Yuzha
• Name: lamin A; endonuclease-mediated mutation 1, Yu Zhang
• MGI ID: MGI:7431464
• Synonyms: Lmna^G609G
• Gene: Lmna Location: Chr3:88388455-88413842 bp, - strand Genetic Position: Chr3, 38.84 cM
• Alliance: Lmna^em1Yuzha page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: The BE4-Gam gene editing system using sgRNA GTGGGCGGATCCATCTCCTC was used to introduce a C to T change at position 1827 (c.1827C>T) resulting in a glycine to glycine substitution at codon 609 (p.G609G). This corresponds to the c.1824C>T, p.G608G dominant mutation seen in over 90% of cases with Hutchinson-Gilford progeria syndrome, which activates a cryptic splice site in exon 11 and produces a truncated laminin A which remains farnesylated. (J:332959)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Lmna Mutation: 84 strains or lines available

References

• Original: J:332959 Hu Q, et al., Anti-hsa-miR-59 alleviates premature senescence associated with Hutchinson-Gilford progeria syndrome in mice. EMBO J. 2023 Jan 4;42(1):e110937
• All: 1 reference(s)