Ppp1r36^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ppp1r36^em1(IMPC)J
• Name: protein phosphatase 1, regulatory subunit 36; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7430813
• Gene: Ppp1r36 Location: Chr12:76464312-76486266 bp, + strand Genetic Position: Chr12, 33.73 cM
• Alliance: Ppp1r36^em1(IMPC)J page
• IMPC: Ppp1r36 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, AGTGTATCCTGAGATACACA and ACAAGCCCAGATGATCCAGC, which resulted in a 10249 bp deletion beginning at Chromosome 12 position 76,427,616 bp and ending after 76,437,864 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000449772, ENSMUSE00000449766, ENSMUSE00000449760, ENSMUSE00000449752, and ENSMUSE00000449748 (exons 4-8) and 9807 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 79 and early truncation 9 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ppp1r36 Mutation: 31 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)