Pom121l2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pom121l2^em1(IMPC)J
• Name: POM121 transmembrane nucleoporin like 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7430792
• Gene: Pom121l2 Location: Chr13:22165364-22172904 bp, + strand Genetic Position: Chr13, 8.11 cM
• Alliance: Pom121l2^em1(IMPC)J page
• IMPC: Pom121l2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGGCAGCTACCTGGGCAAAG and CTTGTAAGTGTGATGTTTCC, which resulted in a 2881 bp deletion beginning at Chromosome 13 position 21,981,578 bp and ending after 21,984,458 bp (GRCm38/mm10). This mutation deletes 2881 bp from ENSMUSE00000378952 (exon 1) and is predicted to generate a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Pom121l2 Mutation: 50 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)