Dcp1b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dcp1b^em1(IMPC)J
• Name: decapping mRNA 1B; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7428749
• Gene: Dcp1b Location: Chr6:119152214-119198575 bp, + strand Genetic Position: Chr6, 56.55 cM
• Alliance: Dcp1b^em1(IMPC)J page
• IMPC: Dcp1b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTGAGCGCTTCATAACCAAG and TCTTCCTCGTGGGGATACCA, which resulted in a 2545 bp deletion beginning at Chromosome 6 position 119,198,637 bp and ending after 119,201,181 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001254689 and ENSMUSE00001256429 (exons 4 and 5) and 2348 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause an early truncation after amino acid residue 107. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Dcp1b Mutation: 24 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)