Pstpip2^em4Tbrd
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pstpip2^em4Tbrd
• Name: proline-serine-threonine phosphatase-interacting protein 2; endonuclease-mediated mutation 4, Tomas Brdicka
• MGI ID: MGI:7427582
• Synonyms: Pstpip2^W232A
• Gene: Pstpip2 Location: Chr18:77882250-77971462 bp, + strand Genetic Position: Chr18, 52.38 cM, cytoband E3
• Alliance: Pstpip2^em4Tbrd page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: CRISPR/Cas9 technology, using an sgRNA (targeting ACTTCTTCCGGAATGCACTG) and an ssODN template, generated a TGG to GCA change resulting in a tryptophan to alanine substitution at amino acid 232 (p.W232A) in exon 10. This change prevents interaction with PEST phosphatases. In addition, sequence of NsiI restriction cleavage site was introduced by changing a C to T in the ATGCAC sequence. Western blot analysis indicated reduced protein levels in neutrophil lysates compared to wild-type protein levels. (J:332442)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Pstpip2 Mutation: 26 strains or lines available

References

• Original: J:332442 Pavliuchenko N, et al., Molecular interactions of adaptor protein PSTPIP2 control neutrophil-mediated responses leading to autoinflammation. Front Immunol. 2022;13:1035226
• All: 1 reference(s)