Pstpip2^em1Tbrd
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pstpip2^em1Tbrd
• Name: proline-serine-threonine phosphatase-interacting protein 2; endonuclease-mediated mutation 1, Tomas Brdicka
• MGI ID: MGI:7427577
• Synonyms: Pstpip2^Y323F
• Gene: Pstpip2 Location: Chr18:77882250-77971462 bp, + strand Genetic Position: Chr18, 52.38 cM, cytoband E3
• Alliance: Pstpip2^em1Tbrd page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: CRISPR/Cas9 technology, using an sgRNA (targeting AGATGATCCTGATTACTCTG) and an ssODN template, generated a TAC to TTT change resulting in a tyrosine to phenylalanine substitution at amino acid 323 (p.Y323F) in exon 14. In addition, sequence of BspEI restriction cleavage site was introduced by changing the second T to G in the TCCTGA sequence. Western blot analysis confirmed expression of normal levels of mutant protein in neutrophil lysates. (J:332442)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Pstpip2 Mutation: 26 strains or lines available

References

• Original: J:332442 Pavliuchenko N, et al., Molecular interactions of adaptor protein PSTPIP2 control neutrophil-mediated responses leading to autoinflammation. Front Immunol. 2022;13:1035226
• All: 1 reference(s)