Hyal6em2(IMPC)H
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Hyal6em2(IMPC)H |
| Name: |
hyaluronoglucosaminidase 6; endonuclease-mediated mutation 2, Harwell |
| MGI ID: |
MGI:7425746 |
| Gene: |
Hyal6 Location: Chr6:24733244-24745451 bp, + strand Genetic Position: Chr6, 11.28 cM, cytoband A3
|
| Alliance: |
Hyal6em2(IMPC)H page
|
| IMPC: |
Hyal6 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at Medical Research Council Harwell using Cas9 and guides with spacer sequences GATCCACTCTGAGTTTCGAA, GGGTAATACCCGAGTTCCTT, TAGAAGCCCCATAAACGCTT, and TATGAATGTTACTCTCACGT that targeted exon(s) ENSMUSE00000191442.2. This resulted in deletion(s) of 367 bp (location: Chr6:24734305-24734671; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
2 reference(s) |
|