About   Help   FAQ
Fgf23em1Pike
Endonuclease-mediated Allele Detail
Summary
Symbol: Fgf23em1Pike
Name: fibroblast growth factor 23; endonuclease-mediated mutation 1, J Wesley Pike
MGI ID: MGI:7425280
Synonyms: FGF23-IKO
Gene: Fgf23  Location: Chr6:127049865-127058371 bp, + strand  Genetic Position: Chr6, 61.92 cM
Alliance: Fgf23em1Pike page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsA putative Fgf23 bone enhancer, located in an Fgf23 intron, was targeted with sgRNAs (targeting TGTCTCTATTATCTGCAGGG and AAACACAAGAAGTTGAGGGC) using CRISPR/Cas9 technology, resulting in a 296 bp deletion. (J:281531)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Fgf23 Mutation:  19 strains or lines available
References
Original:  J:281531 Lee SM, et al., A Control Region Near the Fibroblast Growth Factor 23 Gene Mediates Response to Phosphate, 1,25(OH)2D3, and LPS In Vivo. Endocrinology. 2019 Dec 1;160(12):2877-2891
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/13/2026
MGI 6.24
The Jackson Laboratory