Fgf23^em1Pike
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fgf23^em1Pike
• Name: fibroblast growth factor 23; endonuclease-mediated mutation 1, J Wesley Pike
• MGI ID: MGI:7425280
• Synonyms: FGF23-IKO
• Gene: Fgf23 Location: Chr6:127049865-127058371 bp, + strand Genetic Position: Chr6, 61.92 cM
• Alliance: Fgf23^em1Pike page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: A putative Fgf23 bone enhancer, located in an Fgf23 intron, was targeted with sgRNAs (targeting TGTCTCTATTATCTGCAGGG and AAACACAAGAAGTTGAGGGC) using CRISPR/Cas9 technology, resulting in a 296 bp deletion. (J:281531)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Fgf23 Mutation: 19 strains or lines available

References

• Original: J:281531 Lee SM, et al., A Control Region Near the Fibroblast Growth Factor 23 Gene Mediates Response to Phosphate, 1,25(OH)2D3, and LPS In Vivo. Endocrinology. 2019 Dec 1;160(12):2877-2891
• All: 1 reference(s)