Del(6Rr147611)3Pike
Endonuclease-mediated Allele Detail

Summary

• Symbol: Del(6Rr147611)3Pike
• Name: deletion, Chr 6, J Wesley Pike 3
• MGI ID: MGI:7425279
• Synonyms: Fgf23^-16KO, FGF23-16KO
• Gene: Del(6Rr147611)3Pike Location: unknown Genetic Position: Chr6, Syntenic

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Del(6Rr147611)3Pike involves 1 genes/genome features (Rr147611) View all
• Mutation details: An Fgf23 bone enhancer, located ~16 kb upstream, was targeted with sgRNAs (targeting GGAGGCGTAAACATCTGATCAGG and CCATGGGCTAGGGTGCGGAATGG) using CRISPR/Cas9 technology, resulting in a 947 bp deletion. The deleted sequence contains putative enhancer Rr147611. (J:281531)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Del(6Rr147611)3Pike Mutation: 0 strains or lines available

References

• Original: J:281531 Lee SM, et al., A Control Region Near the Fibroblast Growth Factor 23 Gene Mediates Response to Phosphate, 1,25(OH)2D3, and LPS In Vivo. Endocrinology. 2019 Dec 1;160(12):2877-2891
• All: 2 reference(s)