About   Help   FAQ
Del(6Rr133122)1Pike
Endonuclease-mediated Allele Detail
Summary
Symbol: Del(6Rr133122)1Pike
Name: deletion, Chr 6, J Wesley Pike 1
MGI ID: MGI:7425277
Synonyms: FGF23-PKO
Gene: Del(6Rr133122)1Pike  Location: unknown  Genetic Position: Chr6, Syntenic
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
  Del(6Rr133122)1Pike involves 1 genes/genome features (Rr133122) View all
 
Mutation detailsAn Fgf23 bone enhancer, located immediately upstream, was targeted with sgRNAs (targeting CACTGGCTGGGTTCCTGGAG and AGACTTCTTAGGCTTGCGGA) using CRISPR/Cas9 technology, resulting in a 3996 bp deletion. The deleted sequence contains putative CTCF-binding site Rr133122. (J:281531)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Del(6Rr133122)1Pike Mutation:  0 strains or lines available
References
Original:  J:281531 Lee SM, et al., A Control Region Near the Fibroblast Growth Factor 23 Gene Mediates Response to Phosphate, 1,25(OH)2D3, and LPS In Vivo. Endocrinology. 2019 Dec 1;160(12):2877-2891
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/13/2026
MGI 6.24
The Jackson Laboratory