Mtmr6^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mtmr6^em1(IMPC)J
• Name: myotubularin related protein 6; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7425017
• Gene: Mtmr6 Location: Chr14:60502677-60539819 bp, + strand Genetic Position: Chr14, Syntenic
• Alliance: Mtmr6^em1(IMPC)J page
• IMPC: Mtmr6 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TAGCCATTTCTTTGAAGAAG and ACAGTGCTGAGGGCAGTGTG, which resulted in a 277 bp deletion beginning at Chromosome 14 position 60,281,868 bp and ending after 60,282,144 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000558120 (exon 4) and 119 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 101 and early truncation 2 amino acids later. There is a single bp A insertion at the deletion site. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Mtmr6 Mutation: 24 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)