Del(3)2Jfm
Endonuclease-mediated Allele Detail

Summary

• Symbol: Del(3)2Jfm
• Name: deletion, Chr 3, James F Martin 2
• MGI ID: MGI:7424890
• Synonyms: Pitx2^deltaE60k
• Gene: Del(3)2Jfm Location: unknown Genetic Position: Chr3, Syntenic

Mutation origin

• Strain of Origin: FVB

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: The putative Pitx2 AF (atrial fibrillation)-related enhancer, located upstream of the gene, was targeted with sgRNAs (targeting GCTGGGAGATACAAAGCCAGG, GCTATTGTTAATGAAGACCA, GAGACACTAATCCAGCCCTG and GCCAAACTATACCCTTCAATG) using CRISPR/Cas9 technology, resulting in an ~62 kb deletion. (J:281534)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Del(3)2Jfm Mutation: 0 strains or lines available

References

• Original: J:281534 Zhang M, et al., Long-range Pitx2c enhancer-promoter interactions prevent predisposition to atrial fibrillation. Proc Natl Acad Sci U S A. 2019 Nov 5;116(45):22692-22698
• All: 1 reference(s)