About   Help   FAQ
Del(3)2Jfm
Endonuclease-mediated Allele Detail
Summary
Symbol: Del(3)2Jfm
Name: deletion, Chr 3, James F Martin 2
MGI ID: MGI:7424890
Synonyms: Pitx2deltaE60k
Gene: Del(3)2Jfm  Location: unknown  Genetic Position: Chr3, Syntenic
Mutation
origin
Strain of Origin:  FVB
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsThe putative Pitx2 AF (atrial fibrillation)-related enhancer, located upstream of the gene, was targeted with sgRNAs (targeting GCTGGGAGATACAAAGCCAGG, GCTATTGTTAATGAAGACCA, GAGACACTAATCCAGCCCTG and GCCAAACTATACCCTTCAATG) using CRISPR/Cas9 technology, resulting in an ~62 kb deletion. (J:281534)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Del(3)2Jfm Mutation:  0 strains or lines available
References
Original:  J:281534 Zhang M, et al., Long-range Pitx2c enhancer-promoter interactions prevent predisposition to atrial fibrillation. Proc Natl Acad Sci U S A. 2019 Nov 5;116(45):22692-22698
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory