Shkbp1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Shkbp1^em1(IMPC)J
• Name: Sh3kbp1 binding protein 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7413928
• Gene: Shkbp1 Location: Chr7:27041558-27055444 bp, - strand Genetic Position: Chr7, 15.88 cM
• Alliance: Shkbp1^em1(IMPC)J page
• IMPC: Shkbp1 gene page

Mutation origin

• Strain of Origin: Not Applicable
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACAGAATTCCCATCCCCCCA and GATTTGGGTGTAAAAATCTA, which resulted in a 3202 bp deletion beginning at Chromosome 7 position 27,351,614 bp and ending after 27,354,815 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001254966, ENSMUSE00001289332, ENSMUSE00001286326, ENSMUSE00001209769, and ENSMUSE00001275973 (exons 5-9) and 2618 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 87 and early truncation 48 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Shkbp1 Mutation: 41 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)