Kcnk12^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kcnk12^em1(IMPC)J
• Name: potassium channel, subfamily K, member 12; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7411391
• Gene: Kcnk12 Location: Chr17:88053229-88105422 bp, - strand Genetic Position: Chr17, 57.87 cM
• Alliance: Kcnk12^em1(IMPC)J page
• IMPC: Kcnk12 gene page

Mutation origin

• Strain of Origin: Not Applicable
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGGCATCATGAACAACCGGC and GCCTTCCCGCCCACTGTGGC, which resulted in a 870 bp deletion beginning at Chromosome 17 position 87,745,950 bp and ending after 87,746,819 bp (GRCm38/mm10). This mutation deletes 870 bp from ENSMUSE00000336157 (exon 2) and is predicted to cause a 290 amino acid deletion beginning after amino acid residue 137 and termination 3 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Kcnk12 Mutation: 24 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)