Grid1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Grid1^em1(IMPC)J
• Name: glutamate receptor, ionotropic, delta 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7411380
• Gene: Grid1 Location: Chr14:34542065-35305336 bp, + strand Genetic Position: Chr14, 20.84 cM
• Alliance: Grid1^em1(IMPC)J page
• IMPC: Grid1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGGTGATTCTGGCATAGCTT and ATTGAGGCAGTAACATATGC, which resulted in a 672 bp deletion beginning at Chromosome 14 position 35,026,496 bp and ending after 35,027,167 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000461599 (exon 4) and 466 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 173 and early truncation 17 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Grid1 Mutation: 59 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)