Adat2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Adat2^em1(IMPC)J
• Name: adenosine deaminase, tRNA-specific 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7408173
• Gene: Adat2 Location: Chr10:13428651-13439120 bp, + strand Genetic Position: Chr10, 4.94 cM, cytoband A2
• Alliance: Adat2^em1(IMPC)J page
• IMPC: Adat2 gene page

Mutation origin

• Strain of Origin: Not Applicable
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATATCATAAACTCACCAACA and ATGCAGCAAGTACAAGAGCC, which resulted in a 476 bp deletion beginning at Chromosome 10 position 13,435,665 bp and ending after 13,436,140 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000098195 (exon 3) and 325 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 67 and early truncation 20 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Adat2 Mutation: 13 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)