Rr231594em1Smun
Endonuclease-mediated Allele Detail
|
Symbol: |
Rr231594em1Smun |
Name: |
regulatory region 231594; endonuclease-mediated mutation 1, Stefan Mundlos |
MGI ID: |
MGI:7407306 |
Synonyms: |
deltaC1 |
Gene: |
Rr231594 Location: Chr11:111543601-111544200 bp Genetic Position: Chr11, Syntenic
|
Alliance: |
Rr231594em1Smun page
|
|
Strain of Origin: |
Not Specified
|
|
Allele Type: |
|
Endonuclease-mediated (Modified regulatory region) |
Mutation: |
|
Intergenic deletion
|
|
|
Mutation details: The CTCF-binding site in the Sox9 topologically associated domain (TAD) was targeted with an sgRNA (targeting TGGATTCCAAAAGAGGGCAG) using CRISPR/Cas9 technology, resulting in its deletion.
(J:282642)
|
|
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Rr231594 Mutation: |
0 strains or lines available
|
|
Original: |
J:282642 Despang A, et al., Functional dissection of the Sox9-Kcnj2 locus identifies nonessential and instructive roles of TAD architecture. Nat Genet. 2019 Aug;51(8):1263-1271 |
All: |
1 reference(s) |
|