About   Help   FAQ
Rr231594em1Smun
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr231594em1Smun
Name: regulatory region 231594; endonuclease-mediated mutation 1, Stefan Mundlos
MGI ID: MGI:7407306
Synonyms: deltaC1
Gene: Rr231594  Location: Chr11:111543601-111544200 bp  Genetic Position: Chr11, Syntenic
Alliance: Rr231594em1Smun page
Mutation
origin
Strain of Origin:  Not Specified
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsThe CTCF-binding site in the Sox9 topologically associated domain (TAD) was targeted with an sgRNA (targeting TGGATTCCAAAAGAGGGCAG) using CRISPR/Cas9 technology, resulting in its deletion. (J:282642)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr231594 Mutation:  0 strains or lines available
References
Original:  J:282642 Despang A, et al., Functional dissection of the Sox9-Kcnj2 locus identifies nonessential and instructive roles of TAD architecture. Nat Genet. 2019 Aug;51(8):1263-1271
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory