About   Help   FAQ
Dp(11)6Smun
Endonuclease-mediated Allele Detail
Summary
Symbol: Dp(11)6Smun
Name: duplication, Chr 11, Stefan Mundlos 6
MGI ID: MGI:7398597
Synonyms: Dup-S
Gene: Dp(11)6Smun  Location: unknown  Genetic Position: Chr11, Syntenic
Mutation
origin
Germline Transmission:  Earliest citation of germline transmission: J:235642
Parent Cell Line:  E14 (ES Cell)
Strain of Origin:  129P2/OlaHsd
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutations:    Duplication, Insertion
 
Mutation detailsThe duplication (chr11:111782129-112202448 (GRCm39)) allele was created through targeting with sgRNAs (targeting CACCGTGCTGAAGTTGAACGATGCG and CACCGTTAGAAATCCTTGTCCCAAC) using CRISPR/Cas9 technology. It duplicates the central section of the Sox9 topologically associated domain (TAD) but not the gene itself. (J:235642)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Dp(11)6Smun Mutation:  0 strains or lines available
References
Original:  J:235642 Franke M, et al., Formation of new chromatin domains determines pathogenicity of genomic duplications. Nature. 2016 Oct 13;538(7624):265-269
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/13/2026
MGI 6.24
The Jackson Laboratory