Dp(11)6Smun
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dp(11)6Smun
• Name: duplication, Chr 11, Stefan Mundlos 6
• MGI ID: MGI:7398597
• Synonyms: Dup-S
• Gene: Dp(11)6Smun Location: unknown Genetic Position: Chr11, Syntenic

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:235642
• Parent Cell Line: E14 (ES Cell)
• Strain of Origin: 129P2/OlaHsd

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutations: Duplication, Insertion
• Mutation details: The duplication (chr11:111782129-112202448 (GRCm39)) allele was created through targeting with sgRNAs (targeting CACCGTGCTGAAGTTGAACGATGCG and CACCGTTAGAAATCCTTGTCCCAAC) using CRISPR/Cas9 technology. It duplicates the central section of the Sox9 topologically associated domain (TAD) but not the gene itself. (J:235642)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Dp(11)6Smun Mutation: 0 strains or lines available

References

• Original: J:235642 Franke M, et al., Formation of new chromatin domains determines pathogenicity of genomic duplications. Nature. 2016 Oct 13;538(7624):265-269
• All: 1 reference(s)