Dp(11)6Smun
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Dp(11)6Smun |
| Name: |
duplication, Chr 11, Stefan Mundlos 6 |
| MGI ID: |
MGI:7398597 |
| Synonyms: |
Dup-S |
| Gene: |
Dp(11)6Smun Location: unknown Genetic Position: Chr11, Syntenic
|
|
| Germline Transmission: |
Earliest citation of germline transmission:
J:235642
|
| Parent Cell Line: |
E14 (ES Cell)
|
| Strain of Origin: |
129P2/OlaHsd
|
|
| Allele Type: |
|
Endonuclease-mediated (Not Applicable) |
| Mutations: |
|
Duplication, Insertion
|
| |
|
Mutation details: The duplication (chr11:111782129-112202448 (GRCm39)) allele was created through targeting with sgRNAs (targeting CACCGTGCTGAAGTTGAACGATGCG and CACCGTTAGAAATCCTTGTCCCAAC) using CRISPR/Cas9 technology. It duplicates the central section of the Sox9 topologically associated domain (TAD) but not the gene itself.
(J:235642)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Dp(11)6Smun Mutation: |
0 strains or lines available
|
|
| Original: |
J:235642 Franke M, et al., Formation of new chromatin domains determines pathogenicity of genomic duplications. Nature. 2016 Oct 13;538(7624):265-269 |
| All: |
1 reference(s) |
|