Rr325em1Smun
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Rr325em1Smun |
| Name: |
regulatory region 325; endonuclease-mediated mutation 1, Stefan Mundlos |
| MGI ID: |
MGI:7398533 |
| Synonyms: |
deltaBor |
| Gene: |
Rr325 Location: Chr11:111413371-111431712 bp Genetic Position: Chr11, Syntenic
|
| Alliance: |
Rr325em1Smun page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Modified regulatory region) |
| Mutation: |
|
Intergenic deletion
|
| |
|
Mutation details: Boundary region (insulator) Rr325 between the topologically associated domains (TADs) that contain the Kcnj16 and Kcnj2 genes and Sox9, respectively, was targeted with sgRNAs (targeting GATCATTTTAGGTAACGACCC and GATTTAGCGTCCCCTAGCATA) using CRISPR/Cas9 technology, resulting in an 18.342 kb deletion (chr11:111413371-111431712 (GRCm39)).
(J:235642)
|
|
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Rr325 Mutation: |
0 strains or lines available
|
|
| Original: |
J:235642 Franke M, et al., Formation of new chromatin domains determines pathogenicity of genomic duplications. Nature. 2016 Oct 13;538(7624):265-269 |
| All: |
2 reference(s) |
|