Tg(Rr250407-Luc)3xPKmm
Transgene Detail

Summary

• Symbol: Tg(Rr250407-Luc)3xPKmm
• Name: transgene insert 3xP, Kenneth M Murphy
• MGI ID: MGI:7397296
• Synonyms: 3xP Luciferase
• Transgene: Tg(Rr250407-Luc)3xPKmm Location: unknown
• Alliance: Tg(Rr250407-Luc)3xPKmm page

Transgene origin

• Strain of Origin: (BALB/c x B6C3)F1

Transgene description

• Transgene Type: Transgenic (Reporter)
• Mutation: Insertion
• Mutation details: The transgene contains the following elements: SV40 transcriptional terminator sequence, three copies of OAP/P1 (octamer-associated protein/P sequence-binding nuclear factor) binding site sequence (CTGGTGTAATAATAAAATTTTCCAATGT) from mouse Il4 promoter/enhancer, Il4 promoter sequence (-58 to + 60 bp with respect to TATA box start), the luciferase gene, and SV40 poly(A) signal sequence. A total of six mouse lines were created (#5, 41, 78, 96, 104, 158), with transgene copy numbers of 5-12. (J:40450)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available

References

• Original: J:40450 Wenner CA, et al., Identification of IL-4 promoter elements conferring Th2-restricted expression during T helper cell subset development. J Immunol. 1997 Jan 15;158(2):765-73
• All: 1 reference(s)