About   Help   FAQ
Tg(Rr250407-Luc)3xPKmm
Transgene Detail
Summary
Symbol: Tg(Rr250407-Luc)3xPKmm
Name: transgene insert 3xP, Kenneth M Murphy
MGI ID: MGI:7397296
Synonyms: 3xP Luciferase
Transgene: Tg(Rr250407-Luc)3xPKmm  Location: unknown  
Alliance: Tg(Rr250407-Luc)3xPKmm page
Transgene
origin
Strain of Origin:  (BALB/c x B6C3)F1
Transgene
description
Transgene Type:    Transgenic (Reporter)
Mutation:    Insertion
 
Mutation detailsThe transgene contains the following elements: SV40 transcriptional terminator sequence, three copies of OAP/P1 (octamer-associated protein/P sequence-binding nuclear factor) binding site sequence (CTGGTGTAATAATAAAATTTTCCAATGT) from mouse Il4 promoter/enhancer, Il4 promoter sequence (-58 to + 60 bp with respect to TATA box start), the luciferase gene, and SV40 poly(A) signal sequence. A total of six mouse lines were created (#5, 41, 78, 96, 104, 158), with transgene copy numbers of 5-12. (J:40450)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
References
Original:  J:40450 Wenner CA, et al., Identification of IL-4 promoter elements conferring Th2-restricted expression during T helper cell subset development. J Immunol. 1997 Jan 15;158(2):765-73
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory