Letmd1^em1Etch
Endonuclease-mediated Allele Detail

Summary

• Symbol: Letmd1^em1Etch
• Name: LETM1 domain containing 1; endonuclease-mediated mutation 1, Edward T Chouchani
• MGI ID: MGI:7388301
• Gene: Letmd1 Location: Chr15:100366904-100377045 bp, + strand Genetic Position: Chr15, 56.31 cM
• Alliance: Letmd1^em1Etch page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/cas9 technology targeting exon 2 generated a 95 bp deletion (5 -CTTCAAAGCTTCACCTTTCTCCGAAGGCGGACGTGAAGAACTTGATTTCT TACGTGGTGACCAAGACAAGAGCGATTAACGGATCGTACCATCGT -3) resulting in a frame shift and a premature stop codon and a knockout of isoform 1. (J:331475)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Letmd1 Mutation: 17 strains or lines available

References

• Original: J:331475 Xiao H, et al., Architecture of the outbred brown fat proteome defines regulators of metabolic physiology. Cell. 2022 Nov 23;185(24):4654-4673.e28
• All: 1 reference(s)