About   Help   FAQ
Letmd1em1Etch
Endonuclease-mediated Allele Detail
Summary
Symbol: Letmd1em1Etch
Name: LETM1 domain containing 1; endonuclease-mediated mutation 1, Edward T Chouchani
MGI ID: MGI:7388301
Gene: Letmd1  Location: Chr15:100366904-100377045 bp, + strand  Genetic Position: Chr15, 56.31 cM
Alliance: Letmd1em1Etch page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR/cas9 technology targeting exon 2 generated a 95 bp deletion (5 -CTTCAAAGCTTCACCTTTCTCCGAAGGCGGACGTGAAGAACTTGATTTCT TACGTGGTGACCAAGACAAGAGCGATTAACGGATCGTACCATCGT -3) resulting in a frame shift and a premature stop codon and a knockout of isoform 1. (J:331475)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Letmd1 Mutation:  17 strains or lines available
References
Original:  J:331475 Xiao H, et al., Architecture of the outbred brown fat proteome defines regulators of metabolic physiology. Cell. 2022 Nov 23;185(24):4654-4673.e28
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/13/2026
MGI 6.24
The Jackson Laboratory