About   Help   FAQ
Ankdd1bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ankdd1bem1(IMPC)J
Name: ankyrin repeat and death domain containing 1B; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7388263
Gene: Ankdd1b  Location: Chr13:96552642-96607766 bp, - strand  Genetic Position: Chr13, 50.56 cM
Alliance: Ankdd1bem1(IMPC)J page
IMPC: Ankdd1b gene page
Mutation
origin
Strain of Origin:  Not Applicable
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTACACTCCTGAGAATGTT and CTTTTGTCATCCAAGTTGGA, which resulted in a 524 bp deletion beginning at Chromosome 13 position 96,420,527 bp and ending after 96,421,050 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001289218 (exon 13) and 322 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 423 and early truncation 21 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ankdd1b Mutation:  18 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory