Eml3em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Eml3em1(IMPC)J |
Name: |
echinoderm microtubule associated protein like 3; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:7386926 |
Gene: |
Eml3 Location: Chr19:8906916-8918946 bp, + strand Genetic Position: Chr19, 6.04 cM
|
Alliance: |
Eml3em1(IMPC)J page
|
IMPC: |
Eml3 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCAGTCAGCCTGCTAATGTG and GAACTACAGGAGTTCTAACG, which resulted in a 2241 bp deletion beginning at Chromosome 19 position 8,932,972 bp and ending after 8,935,212 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000621540, ENSMUSE00000621539, ENSMUSE00000621538, ENSMUSE00000621537, ENSMUSE00000621536, and ENSMUSE00000621535 (exons 5-10) and 1601 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 189 and early truncation 127 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
1 reference(s) |
|