Serpinb13em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Serpinb13em1(IMPC)J |
Name: |
serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 13; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:7385116 |
Gene: |
Serpinb13 Location: Chr1:106908714-106928925 bp, + strand Genetic Position: Chr1, 50.34 cM
|
Alliance: |
Serpinb13em1(IMPC)J page
|
IMPC: |
Serpinb13 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGAAGAATAGAGATGTCCAT and GCATCTCTCCACGAATGCAG, which resulted in a 928 bp deletion beginning at Chromosome 1 position 106,995,664 bp and ending after 106,996,591 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001240769 and ENSMUSE00000253941 (exons 4 and 5) and 681 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause an early truncation after amino acid residue 74.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
1 reference(s) |
|