About   Help   FAQ
Serpinb13em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Serpinb13em1(IMPC)J
Name: serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 13; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7385116
Gene: Serpinb13  Location: Chr1:106908714-106928925 bp, + strand  Genetic Position: Chr1, 50.34 cM
Alliance: Serpinb13em1(IMPC)J page
IMPC: Serpinb13 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGAAGAATAGAGATGTCCAT and GCATCTCTCCACGAATGCAG, which resulted in a 928 bp deletion beginning at Chromosome 1 position 106,995,664 bp and ending after 106,996,591 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001240769 and ENSMUSE00000253941 (exons 4 and 5) and 681 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause an early truncation after amino acid residue 74. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Serpinb13 Mutation:  36 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory