Rr323^em1Juhi
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr323^em1Juhi
• Name: regulatory region 323; endonuclease-mediated mutation 1, Junji Hirota
• MGI ID: MGI:7384821
• Synonyms: deltaJ
• Gene: Rr323 Location: Chr7:102159128-102159557 bp Genetic Position: Chr7, Syntenic
• Alliance: Rr323^em1Juhi page

Mutation origin

• Strain of Origin: (C57BL/6 x C3H)F1

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: The class I olfactory receptor olfactory sensory neuron (OSN) enhancer was targeted with sgRNAs (targeting CACCGTCTCATTGCCACCCGGATGA, AAACTCATCCGGGTGGCAATGAGAC, CACCGCCCCTCCACCGTACTTGCA and AAACTGCAAGTACGGTGGAGGGGC) using CRISPR/Cas9 technology, resulting in a 1982 bp deletion. (J:254398)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr323 Mutation: 0 strains or lines available

References

• Original: J:254398 Iwata T, et al., A long-range cis-regulatory element for class I odorant receptor genes. Nat Commun. 2017 Oct 12;8(1):885
• All: 1 reference(s)