Rr322^em1Itan
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr322^em1Itan
• Name: regulatory region 322; endonuclease-mediated mutation 1, Ichiro Taniuchi
• MGI ID: MGI:7384493
• Synonyms: Ccl5^deltaDE
• Gene: Rr322 Location: Chr11:82073395-82073906 bp Genetic Position: Chr11, Syntenic
• Alliance: Rr322^em1Itan page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: The Ccl5 distal enhancer was targeted with sgRNAs (targeting ATCTTAGGATGACTCCACCC and GGAGTGGTTTAAATATAGGA) using CRISPR/Cas9 technology, resulting in a 512 bp deletion. (J:287321)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr322 Mutation: 0 strains or lines available

References

• Original: J:287321 Seo W, et al., Runx-mediated regulation of CCL5 via antagonizing two enhancers influences immune cell function and anti-tumor immunity. Nat Commun. 2020 Mar 26;11(1):1562
• All: 1 reference(s)